Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

210 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

phylim: a phylogenetic limit evaluation library built on cogent3

Coverage Status Release DOI

phylim evaluates the identifiability when estimating the phylogenetic tree using the Markov model. The identifiability is the key condition of the Markov model used in phylogenetics to fulfil consistency.

Establishing identifiability relies on the arrangement of specific types of transition probability matrices (e.g., DLC and sympathetic) while avoiding other types. A key concern arises when a tree does not meet the condition that, for each node, a path to a tip must exist where all matrices along the path are DLC. Such trees are not identifiable 🪚🎄! For instance, in the figure below, tree T' contains a node surrounded by a specific type of non-DLC matrix, rendering it non-identifiable. In contrast, compare T' with tree T.

phylim provides a quick, handy method to check the identifiability of a model fit, where we developed a main cogent3 app, phylim. phylim is compatible with piqtree, a python library that exposes features from iqtree2.

The following content will demonstrate how to set up phylim and give some tutorials on the main identifiability check app and other associated apps.

tree1

Installation

pip install phylim

Let's see if it has been done successfully. In the package directory:

pytest

Hope all tests passed! ✅ 😊

Run the check of identifiability

If you fit a model to an alignment and get the model result:

>>> from cogent3 import get_app, make_aligned_seqs

>>> aln = make_aligned_seqs(
...    {
...        "Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
...        "Gorilla": "ATGCGGCGCGCGGAGGCCGCGCTCGCGGAG",
...        "Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
...    },
...    info={"moltype": "dna", "source": "foo"},
... )

>>> app_fit = get_app("model", "GTR")
>>> result = app_fit(aln)

You can easily check the identifiability by:

>>> checker = get_app("phylim")

>>> checked = checker(result)
>>> checked.is_identifiable

True

The phylim app wraps all information about phylogenetic limits.

>>> checked
Source Model Name Identifiable Has Boundary Values Version
brca1.fasta GTR True True 2025.1.12

You can also use features like classifying all matrices or checking boundary values in a model fit.

Label all transition probability matrices in a model fit

You can call classify_model_psubs to give the category of all the matrices:

>>> from phylim import classify_model_psubs

>>> labelled = classify_model_psubs(result)
>>> labelled
Substitution Matrices Categories
edge namematrix category
GorillaDLC
HumanDLC
MouseDLC
Check if all parameter fits are within the boundary
>>> from phylim import check_fit_boundary

>>> violations = check_fit_boundary(result)
>>> violations
BoundsViolation(source='foo', vio=[{'par_name': 'C/T', 'init': np.float64(1.0000000147345554e-06), 'lower': 1e-06, 'upper': 50}, {'par_name': 'A/T', 'init': np.float64(1.0000000625906854e-06), 'lower': 1e-06, 'upper': 50}])

❗For users who want to check identifiability on a model with multiple likelihood functions (e.g. split codon model), please check #23 (comment)

Check identifiability for piqtree

phylim provides an app, phylim_to_model_result, which allows you to build the likelihood function from a piqtree output tree.

>>> phylo = get_app("piq_build_tree", model="GTR")
>>> tree = phylo(aln)

>>> lf_from = get_app("phylim_to_model_result")
>>> result = lf_from(tree)

>>> checker = get_app("phylim")
>>> checked = checker(result)
>>> checked.is_identifiable

True

Colour the edges for a phylogenetic tree based on matrix categories

If you obtain a model fit, phylim can visualise the tree with labelled matrices.

phylim provides an app, phylim_style_tree, which takes an edge-matrix category map and colours the edges:

>>> from phylim import classify_model_psubs

>>> edge_to_cat = classify_model_psubs(result)
>>> tree = result.tree

>>> tree_styler = get_app("phylim_style_tree", edge_to_cat)
>>> tree_styler(tree)

tree1

You can also colour edges using a user-defined edge-matrix category map, applicable to any tree object!

>>> from cogent3 import make_tree
>>> from phylim import SYMPATHETIC, DLC

>>> tree = make_tree("(A, B, C);")
>>> edge_to_cat = {"A":SYMPATHETIC, "B":SYMPATHETIC, "C":DLC}

>>> tree_styler = get_app("phylim_style_tree", edge_to_cat)
>>> tree_styler(tree)

tree1

About

Python project to validate a phylogenetic fitted models is within the limits of inference

Topics

Resources

Stars

Watchers

Forks

Releases

Packages

Used by

Contributors

Languages