Skip to content

Repository files navigation

Flexify

An R tool for automated custom probe design for 10x Genomics fixed RNA profiling platforms. Flexify supports two probe design workflows:

  • Fusion probes — 50 bp probes spanning a fusion gene junction, scored and ranked across all possible junction offsets.
  • Non-fusion probes — 50 bp antisense probes tiled along a wild-type transcript sequence (e.g. GFP, CRISPR reporter, or any exogenous/custom gene).

Both workflows support Chromium Flex (v1), GEM-X Flex (v2), and Visium FFPE / CytAssist assay formats, automated BLAST-based off-target screening, probeset competition checking, and generate full synthesis-ready LHS and RHS probe sequences including the required 10x Genomics handle sequences.


Quick Start (Shiny App)

This section walks you through launching the Flexify app with no command-line experience required.

Step 1 — Install R

Download and install R from https://cran.r-project.org. Choose the version for your operating system (Windows, macOS, or Linux) and follow the installer prompts.

Step 2 — Install RStudio

RStudio is a user-friendly interface for running R. Download the free Desktop version from https://posit.co/download/rstudio-desktop and install it.

Step 3 — Install required R packages

Open RStudio. In the Console panel at the bottom, paste the following and press Enter:

install.packages(c("shiny", "tidyverse", "DT", "stringr", "optparse"))

This only needs to be done once. It may take a few minutes to complete.

Step 4 — Download Flexify

Click the green Code button at the top of this page and select Download ZIP. Unzip the downloaded folder somewhere convenient on your computer.

Step 5 — Open and run the app

  1. In RStudio, go to File → Open File and navigate to the unzipped Flexify folder.
  2. Open flexify_app.R.
  3. Click the Run App button that appears in the top-right corner of the editor panel.

The Flexify app will open in a new window (or in your browser). You can now upload your input file and start designing probes.

Note: The off-target BLAST check (Tab 2) is optional but recommended. It requires additional software (BLAST+) and a pre-built reference transcriptome database — see the Installation section below. Alternatively, probe sequences can be screened manually using NCBI BLAST or any other BLAST interface, and any off-target hits should be taken into account when selecting probes in Tab 3.


Installation

R dependencies

install.packages(c("shiny", "tidyverse", "DT", "stringr", "optparse"))

BLAST+ (required for off-target checking only)

The easiest way to install BLAST+ is via conda or mamba, which handles all platforms automatically:

# With conda:
conda install -c bioconda blast

# With mamba (faster):
mamba install -c bioconda blast

Alternatively, platform-specific binaries are available from NCBI: https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/

Verify installation:

blastn -version

Build a nucleotide database from your reference transcriptome FASTA:

makeblastdb -in transcriptome.fa -dbtype nucl -out transcriptome_db

Demo

The following commands use the bundled example file and can be run from the repository root. They require R and the R packages listed under Installation. Runtime is a few seconds on a laptop.

1 — Design fusion probes from a generic CSV

Rscript flexify_cli.R \
  --input example_data/test_generic_input.csv \
  --output demo_probes.csv

This reads the four-column CSV (gene1, gene2, gene1_transcript, gene2_transcript), enumerates all junction-offset candidates for each fusion, scores and ranks them, and writes the full ranked table to demo_probes.csv. For the 32-fusion example file this produces 251 ranked candidates in ~1 second. Fusions where gap regions overlap the breakpoint window are skipped with a warning.

Arriba TSV input: if your fusion caller is Arriba, pass the TSV directly with the --arriba flag and Flexify will parse the fusion_transcript column automatically:

Rscript flexify_cli.R --arriba --input fusions.tsv --output demo_probes.csv

2 — Finalise probes (add handle sequences)

Once you have selected one probe per fusion (fill the Selected and Barcode columns in the CSV, or use Tab 3 of the Shiny app), run the finalise step to append the full LHS and RHS handle sequences ready for oligonucleotide synthesis.

Chromium Flex v1 (barcode embedded in probe):

Rscript flexify_cli.R \
  --mode finalise \
  --input selected_probes.csv \
  --output final_probes_v1.csv

GEM-X Flex v2 (barcode in kit reagents, not in probe):

Rscript flexify_cli.R \
  --mode finalise \
  --assay-version v2 \
  --input selected_probes.csv \
  --output final_probes_v2.csv

Visium FFPE / CytAssist (30-nucleotide poly-A tail on RHS):

Rscript flexify_cli.R \
  --mode finalise \
  --assay-version visium \
  --input selected_probes.csv \
  --output final_probes_visium.csv

The output CSV contains synthesis-ready LHS and RHS columns for each selected probe.

3 — Design non-fusion probes from a wild-type transcript CSV

For tiled probes against a wild-type sequence (e.g. GFP, a CRISPR reporter, or any exogenous gene), use the --nonfusion flag with a 2-column CSV (gene, sequence):

Rscript flexify_cli.R \
  --nonfusion \
  --input example_data/test_nonfusion_input.csv \
  --output demo_nonfusion_probes.csv

This designs probes for all 4 genes in the example file and writes 343 ranked candidates in ~5 seconds (most of which is R startup time).

The BLAST and finalise modes also accept --nonfusion:

# Off-target check (screens both halves independently):
Rscript flexify_cli.R --mode blast --nonfusion \
  --input demo_nonfusion_probes.csv \
  --blast-db /path/to/transcriptome_db \
  --output demo_nonfusion_filtered.csv

# Finalise (v1, with barcode):
Rscript flexify_cli.R --mode finalise --nonfusion \
  --input selected_nonfusion.csv \
  --output final_nonfusion_v1.csv

# Finalise (v2, no barcode):
Rscript flexify_cli.R --mode finalise --nonfusion --assay-version v2 \
  --input selected_nonfusion.csv \
  --output final_nonfusion_v2.csv

# Finalise (Visium, poly-A tail):
Rscript flexify_cli.R --mode finalise --nonfusion --assay-version visium \
  --input selected_nonfusion.csv \
  --output final_nonfusion_visium.csv

File Structure

Flexify/
├── flexify_app.R          # Shiny app (main entry point for interactive use)
├── flexify_cli.R          # Command-line interface
├── flexify_core.R         # Core fusion probe design functions
├── flexify_nonfusion.R    # Non-fusion probe design and competition check functions
├── flexify_offtarget.R    # BLAST off-target checking functions (fusion and non-fusion)
├── flexify_handles.R      # Handle/barcode appending functions (fusion and non-fusion)
└── README.md

All .R files must be in the same directory.


Input Formats

Fusion probes

Flexify supports two fusion input formats in both the Shiny app and the CLI.

Option 1: Arriba TSV (direct output)

Upload the TSV file produced directly by Arriba. Flexify parses the fusion_transcript column automatically, extracting gene names and splitting the sequence at the | breakpoint marker. Rows where the fusion transcript is absent or lacks a | separator are skipped with a warning.

Option 2: Generic CSV (any fusion caller)

For output from any other fusion caller (e.g. STAR-Fusion, FusionCatcher), prepare a CSV with the following four columns:

Column Description
gene1 Name of the first fusion partner gene
gene2 Name of the second fusion partner gene
gene1_transcript mRNA sequence of gene1 ending at the breakpoint (5'→3', at least 25 bp)
gene2_transcript mRNA sequence of gene2 starting at the breakpoint (5'→3', at least 25 bp)

Column names are case-insensitive. Sequences should be in DNA alphabet (A/T/G/C). Both sequences must contribute at least 25 nucleotides to allow probe enumeration across the full junction offset range.

Example:

gene1,gene2,gene1_transcript,gene2_transcript
BCR,ABL1,ATGCGT...CCAGTA,TTAGCC...GAATTC
EML4,ALK,CCGTAA...TTAGCA,AACGGT...CCTGAA

Non-fusion probes

Prepare a CSV with the following two columns:

Column Description
gene Gene or construct name (used to label outputs)
sequence Full mRNA/transcript sequence in DNA alphabet (A/T/G/C); at least 50 bp

Column names are case-insensitive. Probes are generated as 50 bp reverse-complement windows tiled across the sequence. Windows with GC content outside 44–72% on either half are excluded.

Example:

gene,sequence
GFP,ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAAC...
TagBFP,ATGGTGAGCGTGATCAAGCCCGACATGCCCATCGTGGAGGGCGGCATGGACGGCTACGTGCTGGAGCCCTTC...

Shiny App

Launch the interactive app from RStudio or the command line:

# From RStudio: open flexify_app.R and click 'Run App'

# From the command line:
Rscript -e "shiny::runApp('flexify_app.R')"

The app has three tabs:

Tab 1 — Design Probes

Select the probe design mode at the top of the sidebar:

  • Fusion probes: Upload an Arriba TSV or a generic 4-column CSV and configure design parameters (restraint, asterix/halves/mRNA markers, penalise left-half junction).
  • Non-fusion probes: Upload a 2-column gene/sequence CSV and configure output options (halves marker, mRNA sequence).

Click Design Probes to run. Results are shown as a summary box (top-ranked probe per fusion or per gene) and a full sortable/filterable table. Two downloads are available:

  • Download All Probes: complete ranked output as CSV.
  • Download Selection Template: same output with empty Selected (FALSE) and Barcode (NA) columns — fill these in externally and re-upload in Tab 3.

Fusion design parameters

  • Min. bases per probe half: the minimum number of bases each fusion partner must contribute to a candidate probe (default: 5).
  • Mark fusion point with *: inserts an asterisk at the exact fusion breakpoint position.
  • Mark probe halves with |: inserts a pipe character at the LHS/RHS boundary (position 25|26).
  • Include mRNA target sequence: appends the reverse complement of the probe.
  • Penalise left-half junction probes: applies a 0.7× score multiplier to probes where the junction falls in the left half.

Non-fusion design parameters

  • Mark probe halves with |: inserts a pipe character at the LHS/RHS boundary.
  • Include mRNA target sequence: appends the mRNA window the probe targets.

Tab 2 — Off-Target & Competition Check

Both checks are optional and can be run in either order after Tab 1.

BLAST off-target check

Screens probe sequences against a reference transcriptome database using BLAST.

Fusion probes: only the junction-spanning half (the half crossing the fusion breakpoint) is queried. The non-junction half binds a wild-type sequence by design and is not screened. A probe is flagged as off-target if its junction half has a hit with fewer than min_mismatches effective mismatches to any transcript.

Non-fusion probes: both the LHS (bases 1–25) and RHS (bases 26–50) halves are queried independently. Because each half will always have a perfect match to its intended target gene, a half is flagged as off-target only if close hits (fewer than min_mismatches effective mismatches) are found to more than one unique transcript. This flags probes where either half may bind unintended targets while accepting the expected on-target hit.

Effective mismatches = aligned_mismatches + (query_length − alignment_length). Provide the BLAST database path (the path prefix used with makeblastdb, without file extension).

Probeset competition check

Checks whether any probe half closely matches a sequence already present in the standard 10x Genomics whole-transcriptome probeset, which could compete for the same target and reduce signal.

Fusion probes: only the non-junction (wild-type) half is checked, since the junction half spans a novel sequence not present in the standard probeset.

Non-fusion probes: both halves are checked independently, since both bind wild-type sequence.

A probe half is flagged as competing if its Hamming distance to any standard probeset sequence is ≤ max_mismatches (default: 2). Provide the bundled probeset CSV or select from the pre-loaded v1/v2 probesets.

Results from both checks are carried forward to Tab 3.

Tab 3 — Select & Finalise

Select your assay version (v1 or v2) in the sidebar before generating final probes. Visium finalisation is available via the CLI (--assay-version visium) but not currently in the Shiny app.

Fusion probes: each fusion (GENE1::GENE2) is shown as a panel with radio buttons listing all ranked candidate probes and a barcode dropdown (v1 only). Select one probe per fusion, assign barcodes (v1), then click Generate Final Probes.

Non-fusion probes: each gene is shown as a panel with radio buttons. Select one probe per gene, assign barcodes (v1 only), then click Generate Final Probes.

CSV upload path: upload a CSV with columns GENE1/GENE2 (fusion) or GENE (non-fusion), probe, and Barcode (v1 only, integer 1–16 or string BC001–BC016). If a Selected column is present, only rows with Selected == TRUE are processed.

The output table contains the full LHS and RHS probe sequences ready for submission to an oligonucleotide synthesis provider.

Chromium Flex (v1)

Barcode-embedded format. Each RHS probe encodes one of 16 Probe Barcodes (BC001–BC016). The barcode must match the corresponding whole transcriptome probe in the hybridisation mix for that sample.

GEM-X Flex (v2)

Barcoding is handled by kit reagents and is not embedded in the custom probe sequence. Select the RHS configuration:

  • Multiplex (CCCATATAAGAAA): standard v2 tail for multiplexed experiments.
  • Singleplex (CGGTCCTAGCAA): tail for the 4-sample singleplex kit.

Command-Line Interface

Mode 1: Design Probes (default)

# Fusion probes from generic CSV:
Rscript flexify_cli.R --input fusions.csv --output probes.csv

# Fusion probes from Arriba TSV:
Rscript flexify_cli.R --arriba --input fusions.tsv --output probes.csv

# Non-fusion probes (gene + sequence CSV):
Rscript flexify_cli.R --nonfusion --input targets.csv --output probes.csv

# With optional flags:
Rscript flexify_cli.R \
  --input fusions.csv \
  --output probes.csv \
  --restraint 5 \
  --mrna \
  --prioritise-rhs

Flags:

Flag Default Description
--input / -i required Input CSV or Arriba TSV (with --arriba)
--output / -o required Output ranked probe CSV
--nonfusion FALSE Non-fusion mode: input must have gene and sequence columns
--arriba FALSE Parse input as an Arriba TSV file (fusion mode only)
--restraint 5 Minimum bases per probe half from each gene (fusion mode only)
--mrna FALSE Include mRNA target sequence column
--prioritise-rhs FALSE Penalise left-half junction probes (fusion mode only)
--no-asterix FALSE Omit fusion breakpoint marker (*) (fusion mode only)
--no-halves FALSE Omit probe half boundary marker (

Mode 2: BLAST Off-Target Check

Rscript flexify_cli.R \
  --mode blast \
  --input probes.csv \
  --blast-db /path/to/transcriptome_db \
  --output probes_filtered.csv

# Keep failed probes in output:
Rscript flexify_cli.R --mode blast -i probes.csv \
  --blast-db /path/db --output probes_flagged.csv --keep-fails

Additional flags:

Flag Default Description
--blast-db required Path to BLAST database (no extension)
--min-mismatches 5 Minimum effective mismatches for a hit to be considered off-target
--threads 1 Number of BLAST threads
--keep-fails FALSE Retain failed probes with flag columns rather than removing

Mode 3: Finalise Probes

# Chromium Flex v1 (default) — barcode embedded in probe:
Rscript flexify_cli.R \
  --mode finalise \
  --input selected_probes.csv \
  --output final_probes.csv

# GEM-X Flex v2 multiplex — no barcode in probe:
Rscript flexify_cli.R \
  --mode finalise \
  --assay-version v2 \
  --input selected_probes.csv \
  --output final_probes.csv

# GEM-X Flex v2 singleplex (4-sample kit):
Rscript flexify_cli.R \
  --mode finalise \
  --assay-version v2 --rhs-mode singleplex \
  --input selected_probes.csv \
  --output final_probes.csv

# Visium FFPE / CytAssist — poly-A tail on RHS:
Rscript flexify_cli.R \
  --mode finalise \
  --assay-version visium \
  --input selected_probes.csv \
  --output final_probes.csv

v1: Input CSV must contain GENE1, GENE2, probe, and Barcode (integer 1–16 or string BC001–BC016).

v2: Input CSV requires only GENE1, GENE2, and probe — no Barcode column.

visium: Input CSV requires only GENE1, GENE2, and probe — no Barcode column.

If a Selected column is present in any case, only rows marked TRUE are processed.

Additional flags:

Flag Default Description
--assay-version v1 Assay version: v1 (Chromium Flex), v2 (GEM-X Flex), or visium (Visium FFPE / CytAssist)
--rhs-mode multiplex v2 RHS tail: multiplex (CCCATATAAGAAA) or singleplex (CGGTCCTAGCAA)

Scoring System

Fusion probes

Each candidate probe is scored on four criteria. The composite score is the product of all four components; any zero score excludes the probe from the output.

Criterion Method Score range
GC content (LHS half) Tiered, based on 10x guidelines 0–5 (0 if outside 44–72%)
GC content (RHS half) Tiered, based on 10x guidelines 0–5 (0 if outside 44–72%)
Junction position Gaussian, optimum at 12.5 bp from centre of each half 0–5
Ligation dinucleotide Preferred set: AT, CA, CT, TA, TC, TG, TT 1 or 3
Homopolymer runs Penalised for runs of 4+ identical bases 1–2

Non-fusion probes

Non-fusion probes are scored on GC content and homopolymer content only (there is no junction position score, since all probes tile uniformly across the transcript). Probes with GC content outside 44–72% on either half receive a score of zero and are excluded.


Probe Structure

The LHS handle sequence is identical across all supported assay formats and both probe types. The RHS structure depends on the assay format.

LHS probe (all formats)

CCTTGGCACCCGAGAATTCCA  [21 bp constant handle]
+ [bases 1–25 of the 50 bp probe]

Total length: 46 bp.

RHS probe — Chromium Flex (v1)

/5Phos/                [5-prime phosphorylation]
+ [bases 26–50 of the 50 bp probe]
+ ACGCGGTTAGCACGTA     [16 bp linker / Constant Sequence]
+ NN                   [2 bp spacer]
+ [8 bp Probe Barcode] [BC001–BC016, unique per sample pool]
+ CGGTCCTAGCAA         [12 bp constant tail]

Total length: 70 characters (excluding /5Phos/).

RHS probe — GEM-X Flex v2 (multiplex)

/5Phos/                [5-prime phosphorylation]
+ [bases 26–50 of the 50 bp probe]
+ CCCATATAAGAAA        [13 bp constant tail]

Total length: 38 characters (excluding /5Phos/). No barcode in probe.

RHS probe — GEM-X Flex v2 (singleplex, 4-sample kit)

/5Phos/                [5-prime phosphorylation]
+ [bases 26–50 of the 50 bp probe]
+ CGGTCCTAGCAA         [12 bp constant tail]

Total length: 37 characters (excluding /5Phos/). No barcode in probe.

RHS probe — Visium FFPE / CytAssist

/5Phos/                [5-prime phosphorylation]
+ [bases 26–50 of the 50 bp probe]
+ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  [30 bp poly-A tail]

Total length: 55 characters (excluding /5Phos/). Spatial barcoding is performed by the Visium slide capture probes, not by the custom probe sequence. The LHS handle is identical to Chromium Flex.

Probe Barcodes (v1 only)

Barcode Sequence Pool
BC001 ACTTTAGG poolOne
BC002 AACGGGAA poolTwo
BC003 AGTAGGCT poolThree
BC004 ATGTTGAC poolFour
BC005 ACAGACCT poolFive
BC006 ATCCCAAC poolSix
BC007 AAGTAGAG poolSeven
BC008 AGCTGTGA poolEight
BC009 ACAGTCTG poolNine
BC010 AGTGAGTG poolTen
BC011 AGAGGCAA poolEleven
BC012 ACTACTCA poolTwelve
BC013 ATACGTCA poolThirteen
BC014 ATCATGTG poolFourteen
BC015 AACGCCGA poolFifteen
BC016 ATTCGGTT poolSixteen

Each v1 RHS probe must use the same barcode as the corresponding whole transcriptome probe in the hybridisation mix for that sample.


Off-Target Assessment

Off-target specificity is assessed by BLAST alignment against the reference transcriptome. The strategy differs by probe type.

Fusion probes: only the junction-spanning half is screened. The non-junction half binds a wild-type sequence by design and is expected to have a perfect match to one of the fusion partner genes. A probe is flagged as off-target if the junction half has a hit with fewer than min_mismatches effective mismatches to any transcript.

Non-fusion probes: both halves (LHS: bases 1–25; RHS: bases 26–50) are screened independently. Because each half will always have a 0-mismatch hit to its intended target gene, a half is only flagged if close hits are found to more than one unique transcript. A probe passes if both halves pass. Note: multiple isoforms of the same gene may generate multiple hits that are each acceptable; the check is intentionally conservative and targets truly off-target binding to unrelated transcripts.

Effective mismatches = aligned_mismatches + (query_length − alignment_length).

Off-target checking can be run:

  • In the app: using Tab 2 with a locally installed BLAST+ and pre-built database.
  • Via the CLI: using --mode blast.
  • Manually: by exporting the probe CSV from Tab 1, running BLAST externally, and filtering before re-importing in Tab 3.

Citation

If you use Flexify in your research, please cite:

[Citation to be added upon publication]


Contact

For issues or questions, please open an issue on GitHub: https://github.com/Oshlack/flexify

About

Automated fusion and non-fusion probe design for the 10x Genomics Flex platform

Resources

Stars

2 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages