[study] TUCCI2025_HEAT_PRIMING (PRJNA1132140)

config/TUCCI2025_HEAT_PRIMING.config

@@ -0,0 +1,70 @@
+/*
+ * AREE :: run configuration for TUCCI2025_HEAT_PRIMING (PRJNA1132140)
+ *
+ * The libraries are Lexogen QuantSeq 3' Tag-Seq (75 bp single-end), so the
+ * run uses --tag_seq (PR #24): fastp trims poly(A) tails, Salmon runs with
+ * --noLengthCorrection, and DESeq2 fits counts without length offsets. Without
+ * it, length offsets can create false fold changes from isoform switching
+ * (workflows/rnaseq/README.md, "3' Tag-seq libraries"). Tank is still not
+ * modelled; see limitations (2) in registry/studies/TUCCI2025_HEAT_PRIMING.yaml.
+ *
+ * The prespecified primary comparison is set below (naive clams, heatwave vs
+ * control). For the second comparison:
+ *   --comparison_id primed_hw_vs_naive_hw \
+ *   --control_level Naïve_Heatwave --treatment_level Primed_Heatwave
+ *
+ *   nextflow run workflows/rnaseq -config config/TUCCI2025_HEAT_PRIMING.config \
+ *     -profile local,workstation
+ *
+ * The sample sheet and FASTQ manifest are generated, not hand-written:
+ *   aree fetch-samplesheet --bioproject PRJNA1132140 --study TUCCI2025_HEAT_PRIMING \
+ *     --condition-attribute Treatment --condition-attribute "Thermal stress" \
+ *     --attribute Clam_ID --library-strategy RNA-Seq
+ *
+ * The reference bundle comes from `aree fetch-reference --assembly ASM2657151v2`
+ * (docs/reference_bundles.md).
+ */
+
+includeConfig 'base.config'
+
+params {
+    mode       = 'raw_reanalysis'
+    single_end = true
+    tag_seq    = true   // QuantSeq 3' Tag-Seq: no length correction anywhere
+
+    rnaseq {
+        study_id           = 'TUCCI2025_HEAT_PRIMING'
+        // Null so --comparison_id on the command line takes effect: the
+        // workflow reads rnaseq.comparison_id first, and a value here would
+        // name every comparison's output after the primary one.
+        comparison_id      = null
+        genome_assembly    = 'GCF_026571515.1'
+        annotation_version = 'GCF_026571515.1-RS_2023_10'
+        processed_results  = null
+    }
+
+    // Prespecified primary comparison (meta_analysis_primary in the study YAML).
+    comparison_id = 'naive_hw_vs_naive_control'
+
+    sample_sheet = 'data/studies/TUCCI2025_HEAT_PRIMING/samplesheet.tsv'
+
+    // Condition levels are Treatment x Thermal stress from the BioSamples.
+    control_level   = 'Naïve_No_Heatwave'
+    treatment_level = 'Naïve_Heatwave'
+
+    // Tank is the unit of treatment (2 tanks per condition), but tank IDs are
+    // not deposited, so replicate_unit cannot be set. The study carries
+    // tank_level_replication; see limitations (2).
+
+    // FASTQ are not committed (13.8 GB for the 40 RNA-seq runs). Verify
+    // against ENA's MD5s in data/studies/TUCCI2025_HEAT_PRIMING/fastq_manifest.tsv.
+    // Single-end: one file per run, sample id = run accession.
+    reads = 'data/raw/TUCCI2025_HEAT_PRIMING/SRR*.fastq.gz'
+
+    transcript_fasta = 'data/reference/GCF_026571515.1/rna.fna'
+    gtf              = 'data/reference/GCF_026571515.1/genomic.gtf'
+    tx2gene          = 'data/reference/GCF_026571515.1/tx2gene.tsv'
+    salmon_index     = null
+
+    outdir = 'results/rnaseq/TUCCI2025_HEAT_PRIMING'
+}

data/studies/TUCCI2025_HEAT_PRIMING/TUCCI2025_HEAT_PRIMING_naive_hw_vs_naive_control_workflow_manifest.json

@@ -0,0 +1,122 @@
+{
+  "workflow_name": "aree-rnaseq",
+  "workflow_version": "0.1.0-scaffold",
+  "mode": "raw_reanalysis",
+  "study_id": "TUCCI2025_HEAT_PRIMING",
+  "comparison_id": "naive_hw_vs_naive_control",
+  "input_files": [
+    {
+      "name": "TUCCI2025_HEAT_PRIMING_naive_hw_vs_naive_control_dge_standardized.tsv",
+      "sha256": "b99f69d1f8522ba4a06102a6f8dcc99c803e6dc3cf70c94ecbf52ff067a75909"
+    }
+  ],
+  "parameters": {
+    "mode": "raw_reanalysis",
+    "study_id": "TUCCI2025_HEAT_PRIMING",
+    "comparison_id": "naive_hw_vs_naive_control",
+    "outdir": "results/rnaseq/TUCCI2025_HEAT_PRIMING/naive_hw_vs_naive_control",
+    "exclude_samples": [],
+    "control_levels": [
+      "Na\u00efve_No_Heatwave"
+    ],
+    "treatment_levels": [
+      "Na\u00efve_Heatwave"
+    ],
+    "replicate_unit": null,
+    "covariates": [],
+    "single_end": true,
+    "se_adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
+    "tag_seq": true,
+    "viral_reference": null
+  },
+  "deseq2_design": {
+    "design": "~condition",
+    "covariates_requested": [],
+    "covariates_used": [],
+    "covariates_dropped_constant": [],
+    "tag_seq": true,
+    "length_model": "none: counts without length offsets (tag_seq)",
+    "n_libraries_or_units": 20,
+    "residual_df": 18
+  },
+  "software_versions": {
+    "DIFFERENTIAL_EXPRESSION_DESEQ2": {
+      "bioconductor-deseq2": "1.50.2",
+      "bioconductor-tximport": "1.38.2",
+      "r-base": "4.5.3"
+    },
+    "FASTQC": {
+      "fastqc": "0.12.1"
+    },
+    "SALMON_INDEX": {
+      "salmon": "2.8.0"
+    },
+    "SALMON_QUANT": {
+      "salmon": "2.8.0"
+    },
+    "SAMPLE_QC": {
+      "multiqc": "1.35"
+    },
+    "STANDARDIZE_OUTPUT": {
+      "pandas": "3.0.6",
+      "python": "3.11.17"
+    },
+    "TRIM_FASTP": {
+      "fastp": "1.4.0"
+    },
+    "EMIT_MANIFEST": {
+      "python": "3.11.17"
+    }
+  },
+  "software_versions_not_captured": {
+    "RENDER_REPORT": "renders this manifest, so it runs afterwards; its versions.yml is published to rnaseq/reports/"
+  },
+  "container_engine": null,
+  "reference": {
+    "genome_assembly": "GCF_026571515.1",
+    "annotation_version": "GCF_026571515.1-RS_2023_10",
+    "transcript_fasta": "data/reference/GCF_026571515.1/rna.fna",
+    "gtf": "data/reference/GCF_026571515.1/genomic.gtf",
+    "tx2gene": "data/reference/GCF_026571515.1/tx2gene.tsv",
+    "salmon_index": null,
+    "files": [
+      {
+        "name": "genomic.gtf",
+        "sha256": "99299a6252c91d941eee4ae579ff540ef08019317ae3c44a7927500cdd46eb0b",
+        "matches_bundle_provenance": true
+      },
+      {
+        "name": "reference_provenance.json",
+        "sha256": "a39261e783dccf164ed976d93a25abc1f871f0d47ffd437218041f3b6cfeb67b"
+      },
+      {
+        "name": "rna.fna",
+        "sha256": "2c45a6c9478b0ff312737772ee3c23019468042fd09bbf2a25a7f263cbfe4014",
+        "matches_bundle_provenance": true
+      },
+      {
+        "name": "tx2gene.tsv",
+        "sha256": "1f76e774cf67286927a3428f570f3f899246e7849e2a60a5a1459de2e396a961",
+        "matches_bundle_provenance": true
+      }
+    ],
+    "bundle": {
+      "bundle": "GCF_026571515.1",
+      "assembly_id": "ASM2657151v2",
+      "ncbi_assembly_accession": "GCF_026571515.1",
+      "annotation_source": "NCBI RefSeq GCF_026571515.1-RS_2023_10",
+      "annotation_release_matches_registry": true,
+      "date_generated": "2026-10-13",
+      "bundler_version": "1.0.0"
+    }
+  },
+  "workflow_start": "2026-10-13T16:54:07.700267-07:00",
+  "qc_metrics": {
+    "mean_reads_per_sample": null,
+    "mean_mapping_rate_percent": null,
+    "n_samples": null,
+    "note": "QC metrics are not populated in processed_results_harmonization mode or in this unexecuted scaffold run."
+  },
+  "viral_load": null,
+  "warnings": []
+}